Calidris mauri

License:

Rights Holder:

Smithsonian Marine Station at Fort Pierce

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Source:

License:

Rights Holder:

NatureServe

Range

Breeds Siberia and Alaska; winters to n South America.

References:

Clements, J. F., T. S. Schulenberg, M. J. Iliff, B.L. Sullivan, C. L. Wood, and D. Roberson. 2012. The eBird/Clements checklist of birds of the world: Version 6.7. Downloaded from http://www.birds.cornell.edu/clementschecklist/downloadable-clements-che...

Source:

Cornell Laboratory of Ornithology

License:

World Register of Marine Species

Distribution

Gulf of Mexico, Irish Exclusive economic Zone, New Zealand Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone

References:

Gordon, D. (Ed.) (2009). New Zealand Inventory of Biodiversity. Volume One: Kingdom Animalia. 584 pp
Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas.
MEDIN (2011). UK checklist of marine species derived from the applications Marine Recorder and UNICORN, version 1.0.
Guiry, M.D. & Guiry, G.M. (2011). Species.ie version 1.0 World-wide electronic publication, National University of Ireland, Galway (version of 15 March 2010).
Ramos, M. (ed.). 2010. IBERFAUNA. The Iberian Fauna Databank

Source:

License:

Rights Holder:

WoRMS for SMEBD

occurs (regularly, as a native taxon) in multiple nations

Source:

License:

Rights Holder:

NatureServe

Global Range: (200,000 to >2,500,000 square km (about 80,000 to >1,000,000 square miles)) BREEDS: islands in Bering Sea, along coasts of western and northern Alaska, northeastern Siberia. Nonbreeding birds spend breeding season south to Panama. NORTHERN WINTER: coastal California and North Carolina south along both coasts, through West Indies, to Peru and Surinam.

Source:

License:

Rights Holder:

NatureServe

Like many shorebirds, C. mauri is found throughout a large range extended by long seasonal migrations. Wintering and migratory stopover populations occur from Washington in the west and Delaware in the east south throughout the Americas to Peru (e.g. Terres 1980). Depending on the season, individuals may be abundant both inland and along the coast. Despite its broad migratory range, this species is known to breed only in western and northern Alaska (Terres 1980; Paulson 2005).Indian River Lagoon (India River Lagoon) Distribution: Little information is available on the distribution of the western sandpiper in the India River Lagoon, but birds are found throughout Florida on tidal flats and sandy beaches (Kale 1990).

References:

Estrella, SM, Masero, JA & A Pérez-Hurtado. 2007. Small-prey profitability: field analysis of shorebirds' use of surface tension of water to transport prey. The Auk 124: 1244-1253.
Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
Fernández, G & DB Lank. 2007. Variation in the wing morphology of western sandpipers (Calidris mauri) in relation to sex, age class, and annual cycle. The Auk 124: 1037-1046.
Johnson, M, Araf, S & JR Walters. 2008. Parent-offspring communication in the western sandpiper. Behav. Ecol. 19: 489-501.
Johnson, M & JR Walters. 2008. Effects of mate and site fidelity on nest survival of western sandpipers (Calidris mauri). The Auk 125: 76-86.
Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
Norris, DR, Lank, DB, Pither, J, Chipley, D, Ydenberg, RC & TK Kyser. 2007. Trace element profiles as unique identifiers of western sandpiper (Calidris mauri) populations. Can. J. Zool. 85: 579-583.
Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
Stein, RW, Fernandez, G, de la Cueva, H & RW Elner. 2008. Disproportionate bill length dimorphism and niche differentiation in wintering western sandpipers (Calidris mauri). Can. J. Zool. 86: 601-609.
Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).

Source:

License:

Rights Holder:

Smithsonian Marine Station at Fort Pierce

Size

Length: 17 cm

Weight: 23 grams

Source:

License:

Rights Holder:

NatureServe

The western sandpiper is the largest of the stints, with a body length of about 16.5 cm and a wingspan ranging from 30 to 36 cm (Terres 1980; Paulson 2005). Lifespan varies with environmental conditions and other factors. Little information is available on the maximum age of C. mauri, but similar species live up to 7 years under certain conditions (Terres 1980).

References:

Estrella, SM, Masero, JA & A Pérez-Hurtado. 2007. Small-prey profitability: field analysis of shorebirds' use of surface tension of water to transport prey. The Auk 124: 1244-1253.
Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
Fernández, G & DB Lank. 2007. Variation in the wing morphology of western sandpipers (Calidris mauri) in relation to sex, age class, and annual cycle. The Auk 124: 1037-1046.
Johnson, M, Araf, S & JR Walters. 2008. Parent-offspring communication in the western sandpiper. Behav. Ecol. 19: 489-501.
Johnson, M & JR Walters. 2008. Effects of mate and site fidelity on nest survival of western sandpipers (Calidris mauri). The Auk 125: 76-86.
Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
Norris, DR, Lank, DB, Pither, J, Chipley, D, Ydenberg, RC & TK Kyser. 2007. Trace element profiles as unique identifiers of western sandpiper (Calidris mauri) populations. Can. J. Zool. 85: 579-583.
Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
Stein, RW, Fernandez, G, de la Cueva, H & RW Elner. 2008. Disproportionate bill length dimorphism and niche differentiation in wintering western sandpipers (Calidris mauri). Can. J. Zool. 86: 601-609.
Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).

Source:

License:

Rights Holder:

Smithsonian Marine Station at Fort Pierce

Look Alikes

The western sandpiper is most easily confused with the semipalmated sandpiper, C. pusilla. As mentioned above, non-breeding adults are very similar in coloration (e.g. Paulson 2005). On average, western sandpipers are larger than C. pusilla and have longer, more curved bills. In flight, the two species are distinguished only by their calls (Peterson 1980) (see 'Voice' below).

References:

Estrella, SM, Masero, JA & A Pérez-Hurtado. 2007. Small-prey profitability: field analysis of shorebirds' use of surface tension of water to transport prey. The Auk 124: 1244-1253.
Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
Fernández, G & DB Lank. 2007. Variation in the wing morphology of western sandpipers (Calidris mauri) in relation to sex, age class, and annual cycle. The Auk 124: 1037-1046.
Johnson, M, Araf, S & JR Walters. 2008. Parent-offspring communication in the western sandpiper. Behav. Ecol. 19: 489-501.
Johnson, M & JR Walters. 2008. Effects of mate and site fidelity on nest survival of western sandpipers (Calidris mauri). The Auk 125: 76-86.
Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
Norris, DR, Lank, DB, Pither, J, Chipley, D, Ydenberg, RC & TK Kyser. 2007. Trace element profiles as unique identifiers of western sandpiper (Calidris mauri) populations. Can. J. Zool. 85: 579-583.
Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
Stein, RW, Fernandez, G, de la Cueva, H & RW Elner. 2008. Disproportionate bill length dimorphism and niche differentiation in wintering western sandpipers (Calidris mauri). Can. J. Zool. 86: 601-609.
Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).

Source:

License:

Rights Holder:

Smithsonian Marine Station at Fort Pierce

Habitat

Habitat and Ecology

Systems

Terrestrial
Freshwater
Marine

Source:

IUCN

License:

Ocean Biogeographic Information System

Rights Holder:

International Union for Conservation of Nature and Natural Resources

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 13.353 - 16.316
  Nitrate (umol/L): 0.240 - 3.951
  Salinity (PPS): 33.239 - 33.496
  Oxygen (ml/l): 5.685 - 6.095
  Phosphate (umol/l): 0.330 - 0.674
  Silicate (umol/l): 1.436 - 5.723

Graphical representation

Temperature range (°C): 13.353 - 16.316

Nitrate (umol/L): 0.240 - 3.951

Salinity (PPS): 33.239 - 33.496

Oxygen (ml/l): 5.685 - 6.095

Phosphate (umol/l): 0.330 - 0.674

Silicate (umol/l): 1.436 - 5.723

Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Source:

License:

Comments: Nonbreeding: mudflats, beaches, shores of lakes and ponds, shallow lagoons, artificial salt ponds, and flooded fields; various coastal habitats with flat or gently sloping muddy, sandy, or gravelly shores; less often inland at pond edges, rain pools, wet fields (Stiles and Skutch 1989). Breeds coastally on sedge-dwarf tundra, on hummocks surrounded by marsh. Nests on the ground in a shallow depression, lined with leaves, lichen, and other plant material. Strong tendency to nest in same area in successive years.

Source:

License:

Rights Holder:

NatureServe

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates northward, mostly along coasts of U.S., early April-early June. Southward migration begins early July, adults prior to juveniles. Nonbreeding birds may not migrate north to breeding range. Uncommon fall and rare spring migrant in Hawaii; occasionally overwinters (Pratt et al. 1987). Migrates through Costa Rica August-November and mid-March to early May (Stiles and Skutch 1989).

Source:

License:

Rights Holder:

NatureServe

Trophic Strategy

Comments: Feeds primarily on aquatic insects; also eats mollusks, worms, and crustaceans. Runs along edge of water snatching up prey from wet mud. See Senner et al. (1989) for information on feeding ecology of migrants at Copper-Bering river delta, south-central Alaska.

Source:

License:

Rights Holder:

NatureServe

The western sandpiper feeds and forages in a similar fashion to the semipalmated sandpiper, walking with its head down while snapping or probing through the sand in search of prey (Terres 1980). This species may also submerge its head to catch a variety of invertebrate prey, and utilize the surface tension of the surrounding water to transport food down the beak (Estrella et al. 2007).Predators: Little information is available concerning predators of the western sandpiper, but birds of prey, alligators and larger mammals probably consume eggs, hatchlings and adults.Parasites: Like many other bird species, the red knot acts as a terminal or final host for several parasites acquired from a variety of prey items, including the parasitic worms, Bartolius pierrei (Cremonte 2004), Skrjabinocerca canutus, Viktorocara capillaries, and V. limosae (Diaz et al. 2005).

References:

Estrella, SM, Masero, JA & A Pérez-Hurtado. 2007. Small-prey profitability: field analysis of shorebirds' use of surface tension of water to transport prey. The Auk 124: 1244-1253.
Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
Fernández, G & DB Lank. 2007. Variation in the wing morphology of western sandpipers (Calidris mauri) in relation to sex, age class, and annual cycle. The Auk 124: 1037-1046.
Johnson, M, Araf, S & JR Walters. 2008. Parent-offspring communication in the western sandpiper. Behav. Ecol. 19: 489-501.
Johnson, M & JR Walters. 2008. Effects of mate and site fidelity on nest survival of western sandpipers (Calidris mauri). The Auk 125: 76-86.
Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
Norris, DR, Lank, DB, Pither, J, Chipley, D, Ydenberg, RC & TK Kyser. 2007. Trace element profiles as unique identifiers of western sandpiper (Calidris mauri) populations. Can. J. Zool. 85: 579-583.
Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
Stein, RW, Fernandez, G, de la Cueva, H & RW Elner. 2008. Disproportionate bill length dimorphism and niche differentiation in wintering western sandpipers (Calidris mauri). Can. J. Zool. 86: 601-609.
Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).

Source:

License:

Rights Holder:

Smithsonian Marine Station at Fort Pierce

Associations

Although there are no obligate associations documented between the western sandpiper and other species, C. mauri is commonly found alongside other organisms from the tidal flat and sandy beach habitats in which it resides. For more extensive information on these ecosystems and their associated species found in and around the IRL, please visit the Tidal Flat and Beach Habitat pages.

References:

Estrella, SM, Masero, JA & A Pérez-Hurtado. 2007. Small-prey profitability: field analysis of shorebirds' use of surface tension of water to transport prey. The Auk 124: 1244-1253.
Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
Fernández, G & DB Lank. 2007. Variation in the wing morphology of western sandpipers (Calidris mauri) in relation to sex, age class, and annual cycle. The Auk 124: 1037-1046.
Johnson, M, Araf, S & JR Walters. 2008. Parent-offspring communication in the western sandpiper. Behav. Ecol. 19: 489-501.
Johnson, M & JR Walters. 2008. Effects of mate and site fidelity on nest survival of western sandpipers (Calidris mauri). The Auk 125: 76-86.
Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
Norris, DR, Lank, DB, Pither, J, Chipley, D, Ydenberg, RC & TK Kyser. 2007. Trace element profiles as unique identifiers of western sandpiper (Calidris mauri) populations. Can. J. Zool. 85: 579-583.
Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
Stein, RW, Fernandez, G, de la Cueva, H & RW Elner. 2008. Disproportionate bill length dimorphism and niche differentiation in wintering western sandpipers (Calidris mauri). Can. J. Zool. 86: 601-609.
Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).

Source:

License:

Rights Holder:

Smithsonian Marine Station at Fort Pierce

Population Biology

Global Abundance

>1,000,000 individuals

Comments: Total population estimated at 3.5 million (Morrison et al. 2001).

Source:

License:

Rights Holder:

NatureServe

The western sandpiper is a common stint, considered abundant despite its limited breeding range (Paulson 2005) (see 'Regional Occurrence' above). Detailed abundance records for sandpiper populations within the IRL are scarce. However, birds are known to stopover in Florida from July through May, and some non-breeding individuals extend their stay throughout the summer (Kale 1990). With the exception of the spring season, the western sandpiper is more abundant in the southeastern U.S. than its prolific relative, C. pusilla (Paulson 2005).

References:

Estrella, SM, Masero, JA & A Pérez-Hurtado. 2007. Small-prey profitability: field analysis of shorebirds' use of surface tension of water to transport prey. The Auk 124: 1244-1253.
Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
Fernández, G & DB Lank. 2007. Variation in the wing morphology of western sandpipers (Calidris mauri) in relation to sex, age class, and annual cycle. The Auk 124: 1037-1046.
Johnson, M, Araf, S & JR Walters. 2008. Parent-offspring communication in the western sandpiper. Behav. Ecol. 19: 489-501.
Johnson, M & JR Walters. 2008. Effects of mate and site fidelity on nest survival of western sandpipers (Calidris mauri). The Auk 125: 76-86.
Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
Norris, DR, Lank, DB, Pither, J, Chipley, D, Ydenberg, RC & TK Kyser. 2007. Trace element profiles as unique identifiers of western sandpiper (Calidris mauri) populations. Can. J. Zool. 85: 579-583.
Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
Stein, RW, Fernandez, G, de la Cueva, H & RW Elner. 2008. Disproportionate bill length dimorphism and niche differentiation in wintering western sandpipers (Calidris mauri). Can. J. Zool. 86: 601-609.
Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).

Source:

License:

Rights Holder:

Smithsonian Marine Station at Fort Pierce

General Ecology

Nonbreeding: forages regularly in large flocks.

Source:

License:

Rights Holder:

NatureServe

Cyclicity

Comments: Migrants in south-central Alaska tended to feed continuously between successive high tides (Senner et al. 1989). See Robert et al. (1989).

Source:

License:

Rights Holder:

NatureServe

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 9.2 years (wild)

Source:

AnAge

License:

Rights Holder:

Joao Pedro de Magalhaes

Reproduction

Breeding begins late May (Harrison 1978). Both sexes, in turn, incubate 4 eggs for 18-19 days (Terres 1980). Nestlings precocial and downy. Young tended by both parents. Up to 500-700 pairs per sq km near Barrow, Alaska.

Source:

License:

Rights Holder:

NatureServe

The leaf and grass-lined nests of C. mauri are typically built in ground depressions on moist to dry arctic tundra or on mossy mountain slopes near sedges and low-lying plants (Terres 1980). Clutch size is generally four eggs per nest. Eggs are cream to light brown and marked with reddish-brown spots and blotches (Terres 1980). Both parents incubate the eggs until they hatch, a period of about 18-19 days. After hatching, chicks are brooded for 5-7 days, and further parental investment includes leading chicks out of the nest and offering protection from predators via territorial displays and parent-offspring signal calls for an additional 2-3 week period (Johnson et al. 2008) (see "Voice" below). Studies have revealed some degree of nesting site and mate fidelity from one breeding season to the next. Of the population surveyed from the Yukon-Kuskokwim River Delta in Alaska, 40-60 % of breeding adults returned to the same nesting site, and 4-29 % returned to the same mate (Johnson & Walters 2008). Results indicated that site and mate fidelity lead to faster clutch initiation and higher nest survival rates. Voice: Western sandpipers emit a variety of calls, depending on the circumstance. During flight, vocal communication consists of a high-pitched, squeaky dzheet, jeet or cheep. While in flight, call variation is the only method for distinguishing C. mauri from the semipalmated sandpiper, which often trills repeatedly and emits a duller sound (Peterson 1980; Paulson 2005). Breeding adults produce a crescendoed trill of brr-eee brr-eee brr-eee breee-urrrrr that drops at the end (Paulson 2005). After hatchlings leave the nest, parents have been documented to use four distinct calls for communicating with offspring, categorized as 'brood', 'alarm', 'freeze' and 'gather' (Johnson et al. 2008). Chicks respond in varying ways, depending on the type of call. In some instances, juveniles notify parents of their location, while others remain silent as an antipredatory response. Temperature &

References:

Estrella, SM, Masero, JA & A Pérez-Hurtado. 2007. Small-prey profitability: field analysis of shorebirds' use of surface tension of water to transport prey. The Auk 124: 1244-1253.
Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
Fernández, G & DB Lank. 2007. Variation in the wing morphology of western sandpipers (Calidris mauri) in relation to sex, age class, and annual cycle. The Auk 124: 1037-1046.
Johnson, M, Araf, S & JR Walters. 2008. Parent-offspring communication in the western sandpiper. Behav. Ecol. 19: 489-501.
Johnson, M & JR Walters. 2008. Effects of mate and site fidelity on nest survival of western sandpipers (Calidris mauri). The Auk 125: 76-86.
Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
Norris, DR, Lank, DB, Pither, J, Chipley, D, Ydenberg, RC & TK Kyser. 2007. Trace element profiles as unique identifiers of western sandpiper (Calidris mauri) populations. Can. J. Zool. 85: 579-583.
Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
Stein, RW, Fernandez, G, de la Cueva, H & RW Elner. 2008. Disproportionate bill length dimorphism and niche differentiation in wintering western sandpipers (Calidris mauri). Can. J. Zool. 86: 601-609.
Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).

Source:

License:

Barcode of Life Data Systems (BOLD)

Rights Holder:

Smithsonian Marine Station at Fort Pierce

Molecular Biology

Barcode data: Calidris mauri

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNTATACCTAATCTTCGGTGCATGAGCTGGTATAGTCGGAACCGCCCTTAGCCTGCTCATTCGTGCAGAACTAGGTCAACCCGGAACCCTCTTAGGAGACGACCAGATCTACAACGTTATTGTCACCGCCCACGCCTTCGTAATAATCTTCTTCATAGTAATGCCAATCATAATTGGTGGCTTCGGAAATTGACTAGTCCCACTTATAATCGGTGCCCCTGACATAGCATTCCCTCGTATAAACAACATAAGCTTCTGACTACTACCCCCATCATTCCTGCTACTACTGGCATCGTCTACAGTAGAAGCCGGAGCAGGTACAGGATGAACAGTATATCCCCCACTTGCTGGTAACCTAGCCCATGCTGGAGCCTCCGTAGACCTAGCCATCTTCTCTCTCCACCTAGCAGGTGTCTCCTCTATCCTAGGTGCCATCAACTTCATCACTACCGCCATTAACATAAAACCTCCAGCCCTCTCTCAATACCAAACACCCTTATTCGTGTGATCAGTACTTATCACCGCCGTTCTACTTTTACTCTCTCTCCCAGTTCTTGCTGCCGGCATTACCATGCTACTAACAGACCGAAACCTAAACACCACATTCTTCGACCCCGCCGGAGGAGGAGACCCAGTCCTATATCAACATCTCTTCTGATTCTTCGGCCACCCAGAAGTTTACATCCTAATCCTA
-- end --

Download FASTA File

Source:

License:

Barcode of Life Data Systems (BOLD)

Rights Holder:

Barcode of Life Data Systems

Statistics of barcoding coverage: Calidris mauri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 22
Species With Barcodes: 1

Source:

License:

Rights Holder:

Barcode of Life Data Systems

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NUB,N4M : NUB: Unrankable - Breeding, N4M: Apparently Secure - Migrant

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Source:

License:

Rights Holder:

NatureServe

IUCN Red List Assessment

Red List Category

Least Concern

Red List Criteria

Version

3.1

Year Assessed

2009

Assessor/s

BirdLife International

Reviewer/s

Bird, J., Butchart, S.

Contributor/s

Justification

This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History

2008

Least Concern
2004

Least Concern

Source:

IUCN

License:

Rights Holder:

International Union for Conservation of Nature and Natural Resources

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Source:

License:

Rights Holder:

NatureServe

Management

Needs: "Regional conservation plans that restore salt marshes for the benefit of endangered species must consider the effects of losing artificial salt-pond habitats, which are locally important for sandpipers" (Warnock and Takekawa 1995).

Source:

License:

Rights Holder:

NatureServe

Benefits

Threats & Conservation: Unlike the related red knot, Calidris canutus rufa, populations of the western sandpiper are strong and no special status has been issued for the species. However, C. mauri is protected under the Migratory Bird Treaty Act of 1918, which prohibits the harassment, capture, kill and/or possession of listed migratory species (e.g. USFWS 2010).

References:

Estrella, SM, Masero, JA & A Pérez-Hurtado. 2007. Small-prey profitability: field analysis of shorebirds' use of surface tension of water to transport prey. The Auk 124: 1244-1253.
Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
Fernández, G & DB Lank. 2007. Variation in the wing morphology of western sandpipers (Calidris mauri) in relation to sex, age class, and annual cycle. The Auk 124: 1037-1046.
Johnson, M, Araf, S & JR Walters. 2008. Parent-offspring communication in the western sandpiper. Behav. Ecol. 19: 489-501.
Johnson, M & JR Walters. 2008. Effects of mate and site fidelity on nest survival of western sandpipers (Calidris mauri). The Auk 125: 76-86.
Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
Norris, DR, Lank, DB, Pither, J, Chipley, D, Ydenberg, RC & TK Kyser. 2007. Trace element profiles as unique identifiers of western sandpiper (Calidris mauri) populations. Can. J. Zool. 85: 579-583.
Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
Stein, RW, Fernandez, G, de la Cueva, H & RW Elner. 2008. Disproportionate bill length dimorphism and niche differentiation in wintering western sandpipers (Calidris mauri). Can. J. Zool. 86: 601-609.
Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).

Source:

License: